Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15016-NR
Clone ID PST15016-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15016-NR
Sequence
TTGGCCCCTTAAGTCTGTGCCAAGGATGTGGAAGAGTTTGTGTAGTTACTCCTGTAACCACAACACTTCCATGGCAAAAT
GGACTTACCCAGGAGCTCAGGCCAACTCTGCACGGCACCCGCTGTACAGCAGCGTGAGACATACTGCCTCAACAGGATGG
AAGAAAAGACTGACTTCAGATAGGGTGATTCTCCCTA
Sequence Type genomic DNA
Unitrap ID UNI6905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44217487..44217682 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009927 (Rps25) NM_024266 ribosomal protein S25 Gene [Source:MGI Symbol;Acc:MGI:1922867]

 
Come back to gene ENSMUSG00000009927


For any suggestions or comments, please send an email to unitrap@crg.es