Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508H3
Clone ID IST14508H3
Vector VICTR74
Project tigm

Sequence tag IST14508H3HMR1
Sequence
ACCCTACTTTTTCTTGAAATATACATAAGACTAAGTGTAAGTTCTGTGGTTATAATAAAGGTCAAGTAAAAATATGAAAA
AAAATTGTTCCCTGCATATGCAGCTTANAATATAAGACTGGTCTAGGTAGCCNGCGCATCAAGTGTATCCCTTGTATGTG
TACCTCANTCTATGAGGGTGGGAAGAAAAATTAATCTGAAGTCCAAGGAT
Sequence Type genomic DNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57286407..57286616 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es