Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13566E9
Clone ID IST13566E9
Vector VICTR74
Project tigm

Sequence tag IST13566E9HMR1
Sequence
GAATATTTNAAATTCATTTTTAATTTCTAATATAAGCATTGATTGAGAAAGCCTACATCTGTAAGAAGTCTCTTTGTATA
TCTTGGCTAGGCAGAGTGAGTACTCCTTGGGATGCAGAAGTAGGTGGGTCTTGAACTGTATAGCCTGGGCTATACAGTAA
AATGCTGTCTCAAAACAAAGAAAAAAAATAACAATGTACTTTTAAAAGGGTGGATTGTATGGCATGTGATTCATGTCC
Sequence Type genomic DNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104442902..104443138 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]


Sequence tag IST13566E9BBF1
Sequence
ATTCAAAGTACTGACCTCAAAAGCCTGGTCTACAGTGTCAATTCCAGGACAGCCANAGCTAACCAAAAACAAACAAACAA
AAAAAACCCTGTCTTGAACCCCCCCTACTCCCGCCAAATCACTATGTATTTTATAAAAATGTACTTTTACAAAAAAAAAA
TGGCTGTGATTGTTTTATACNCNGAACAATCAAATTTAGGTACTGTGCATGTCANNAAAAANNCNACTACTGANCTNCTC
CCCAACCAANAAATTNTTTNTCNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es