Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059B6
Clone ID IST15059B6
Vector VICTR80
Project tigm

Sequence tag IST15059B6HMR1
Sequence
NNATACTAGATTTGTGCCTGTGTGTGAACTTGAAGGAAGAGCAGGGAAGGGTCAGACAGCCTGCTTGAATGGGGTTGCAA
ATTCCTCTGCTGGCAAACTCGAGTGCAGGGAAATGTCACCCGCTTGTTGCTTTTTATGGTCATGAAGAAGGAAAACCTCC
AAGGCTTTCGATCCCTTTGCTGGGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060439..6060624 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST15059B6BBF1
Sequence
TATTCACTCTGCAGGATCGGGCAAGGGCTTGAGGAACATAGTAATTTATAGCTTTTAAACTCCACAGTAGTCCAATTGTC
TCCAGCCCTAGAAAACGGGGTGAGGGAGAGTGCGAAGGCTTAATGCGGGGCTTGAAATTAAACCTGTAAACAGTTATTAT
TGCAGTCAGAAAGTCGAATGAAATCTGAAGCAGGTTATCTGGATTCTTTGAACAATAAGGTCAACTCTGAGAGTTCTGGA
AACTAAATTTTCTAAACCATCCCTATTGTTGCCCCATTTTCTGCTTCATCTCCTATGCGCCTCGCCCTGTTGACTATCGC
CACATCTGGCTGCAATTAAATAAGAAGATAAGATTTTTTAAAAAGGGATAGGTAGGTAGGGTGGCTCTGGGCTCCAAACC
TCANCACTTGGGANGCTGAANCAGGAGGATCAAGAGCTCCTACCTANCANGGATAGCCTGTCTCAAAAGANGCACANGAC
ATANGTTTGANTCCCCANTGNNNNAAAAAATANNCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060622..6061139 486
 
EST/CDNA Est Name
  CA881784.1 - BB665546.1 - CD539677.1 - CD540754.1


Sequence tag IST15059B6HMF1
Sequence
TATTCACTCTGCAGGATCGGGCAAGGGCTTGAGGAACATAGTAATTTATAGCTTTTAAACTCCACAGTAGTCCAATTGTC
TCCAGCCCTAGAAAACGGGGTGAGGGAGAGTGCGAAGGCTTAATGCGGGGCTTGAAATTAAACCTGTAAACAGTTATTAT
TGCAGTCAGAAAGTCGAATGAAATCTGAAGCAGGTTATCTGGATTCTTTGAACAATAAGGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060622..6060846 225
NO GENE  

 
Come back to gene CA881784.1 - BB665546.1 - CD539677.1 - CD540754.1


For any suggestions or comments, please send an email to unitrap@crg.es