Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14981-NR
Clone ID PST14981-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14981-NR
Sequence
CTCTGACCAGGCTGGGAGAGTCTTAGTGTGGCCATAGCTCAGAACGAGTACCATCTCCTGGACACGCCCTGTGGTTGGTG
CGGCAGGATCATCCGCTGGTCCCAGCTCTCTGAGGGTTCCACTCCTGTCTCTGCAGCCTACACAGATGACCTGGGTGCTG
TGGGTGGTGCATG
Sequence Type genomic DNA
Unitrap ID UNI14707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143142678..143142850 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es