Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14056H7
Clone ID IST14056H7
Vector VICTR74
Project tigm

Sequence tag IST14056H7HMF2
Sequence
TTTTCTTGTGCAGGGGACTTCCTCATCATAGGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154998420..154998456 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST14056H7BBF1
Sequence
GTTTGAGGCTCTCCAACCCCAGAACCTGAGTGGCCCAGCTCTCTCTGCATGCAGTATTCTATCTATCATGCATTTATAGC
TTTTGATTTCCTTAGGTGCCTAGGGAGATTGGCACTGTGGCAGTGTAAGGGGGCAGAGGCATGAGCCCTTCTTCAGGGAG
ACCCTGAATTAAAACCTGCCTGAATCATAACAAGGACCCCACCCCTACCCCAAAATCCCCGTGAGACTCTTANGGGCTCA
GGGGAGGGAATGATTGCTGGAAGTCTGGAGTCAGGCAGCCTGTCTCTTGCTGACCTACATCCTCCCTGTTGCCNGGTATG
GCCAGAAGCNCAGGTATACTCATACCCATTTAATGAATGACACCATCAANGCTCAAAGANGTCAAAAGANTCACCCACTG
CTTCAATAGTATAAAGTGNCANANCCTGCCACTCTGTGGCCNCAANTACNANNCAACCCCACCTAAGCANCTGTGANNTG
GANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29537982..29538463 446
NO GENE  

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es