Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13826A7
Clone ID IST13826A7
Vector VICTR74
Project tigm

Sequence tag IST13826A7HMF2
Sequence
TGATCNTGAAGGCACATTGGATTTTTGTTTTTTGTTTTTTTGTTTGTTTTGGTTTTTCGAGACNNGGTTTCTCTGTATAN
CCCTGGCTGTCCTGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13826A7BBF1
Sequence
TGATCATGAAGGCACATTGGATTTTTGTTTTTTGTTTTTTTGTTTGTTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAG
CCCTGGCTGTCCTGGC
Sequence Type genomic DNA
Unitrap ID UNI34600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77846..781947 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069044 (Usp9y) NM_148943 ubiquitin specific peptidase 9, Y chromosome Gene [Source:MGI (curated);Acc:Usp9y-001]

 
Come back to gene ENSMUSG00000069044


For any suggestions or comments, please send an email to unitrap@crg.es