Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14379G9
Clone ID IST14379G9
Vector VICTR74
Project tigm

Sequence tag IST14379G9BBF1
Sequence
GTCTTAGCTGGGCGCCCCGTGCCGGCAAAAAGAGCTCTTCAAGTACTCCAGTTCAGACCCACCGCTGTCCCCAACTACGC
CGCAGAAGTTTCTGTCTTTTCCTGCATCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI20228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127529570..127529684 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]


Sequence tag IST14379G9HMF2
Sequence
GATTGTGTTCTCCCTGCATCCAAGCCTTCTTACGGCTTGCAGTAAATAAAAACTTCCCAGTGTGGTTCTGTTTTGTTTTT
AGCTAGGGTATATAGCCCAGGCTGACTCCATCGTCCTCCCTAAATAGCTAAGATTACAGGCGTGAGTCACCACACCAGGC
TTCCCGTAACTCTTGCTTTCCCCTCAGGCTTTCCTTGGTCAGCTTTCCTCCAAAAGGTCTTTTCTAGCCCGACCTAGGGC
TGCTCNNNTTATTCACAGGCTTTCAAGTTCCCACCCCCAACCCCACCCCGCCTCTCCCAGTCTTAGATCCAGGTTTCNNN
NGGTGGAACATTCNNNANCTTANTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124755250..124755596 323
 
EST/CDNA Est Name
  AI153827.1

 
Come back to gene AI153827.1


For any suggestions or comments, please send an email to unitrap@crg.es