Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12124H4
Clone ID IST12124H4
Vector VICTR76
Project tigm

Sequence tag IST12124H4BBF1
Sequence
AGGTGACTGTCATTGTCCTCATTCCCTTTCAAGGGCATAGTCTATCAGTATCTGTCATCGGTGCTAACCTTGTTCTTGGG
CTGTGCTCCTTGGCTTTCTCTAAGGGGTCCTGGCTGCTTGCTTCANAAAGAAGTCATTGAGGTCAGTCTTCCCTGGAGTA
GGGACTTAACTGTTGAGGTGGAATATCTGCAGCAATTATTTAAAATCCTCCTCAGTGGGAGATTTGCCTCTGTTCCCTCG
CTCATATTTATTCATTCNATCATTAATTCCATACCGTGCAATCCTGCTTTATCTTGCTGTTCCAGCTGCCCACTGTANCC
TGTGGAGTGCTANCATTTGGCTCCGGAATCCCTTCNACATACTCCAAGGTGGTGGGAGCCTGCCTGANGGTTTCTCTTTC
ACTTGCTGACATTACAAGATGCTACAAGGTCACCTAAATCTCTACAACTCTNATCCTANAATCNCAACTCTATTNAGTTN
TGANAATGNNAATTATTACNCNCNCNCNCNCACACACNCNNNCNCNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91985567..91986083 477
NO GENE  


Sequence tag IST12124H4HMR1
Sequence
NCTCTGCTANNNNNACACACCCTTCCCACCAACCCTCCAACTGCCCTGGTGGAGTCACGAGAAAAATCCCAATTGANAAG
CATG
Sequence Type genomic DNA
Unitrap ID UNI31455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91986096..91986165 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST12124H4HMF1
Sequence
AGGTGACTGTCATTGTCCTCATTCCCTTTCAAGGGCATAATCTATCANTATCTGTCATCGGTGCTAACCTTGTTCTTGGG
CTGTGCTCCTTGGCTTTCTCTAAGGGGTCCTGGCTGCTTGCTTCNNAAAGAANTCATTGAGGTCNNTCTTCCCTGGAGTA
GGGACTTANCTGTTGANGTGGANTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es