Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15109B7
Clone ID IST15109B7
Vector VICTR80
Project tigm

Sequence tag IST15109B7BBF1
Sequence
AAGGGTCAGTGGTTAAAAGATTACAAATCTTGCTCTATTCCATTTGCATTTAGCTAAAATATCATAGGTCATTCTATTGC
TTTGGAATCACTCTGTGTTTAGGTCTGTTTTTTAAAATCTACTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45586946..45587085 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST15109B7HMF2
Sequence
NAGGGTCANTGGTTAAAAGATTACAAATCTTGCTCTATTCCATTTGCATTTACCTAAAATATCATANGTCATTCTATTGC
TTTGGAATCACTCTGTGTTTAGGTCTGTTTTTTAAAATCTACTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45586945..45587084 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST15109B7HMR1
Sequence
CCTAATTCCTAANGCNNNCCTTTTTTANGGATAACATTTACANCAGCTTTTCANANNNNNNTGGGANCGCNNTCNNNNCN
TTANTATTTTNNTCNGGAGGCNNGGGTTAGATTACTCTTACCCTGATGAATAATATATGCTGACCCANCACACAGTTTCA
GCTCAGTGACTAACAAAGATGTGCATGGACCATGGTATTCCAAGCTTATACTTCTTCATCGGTAGACAGAGGGATGACCA
CACAGTGAAGACTAACCATGAATATGAATGCGAATTACTAAACAGAACCCAGACCACATAGCCCAGCCTTTGGGGGACTC
AGAGTTTACTAAACAATAAGCCCAAATCAGAGAATGTATCTGTAGGAAATATATAATATGAAACTTAGAAATGTGAATGC
AAAGTATTATTTCTGTCTGTTACGCCTACGTGGAAAAGCAACCNAGCTATTTNAGTCNGTTCTAACTTCCTTTAAGGNCA
CTTTTCTGANCCNAATGAACAGTTCTGTCTTCTAAAAACATCCNGTGATGGCTTGGANGAGGAATCCANNANNTCAATTT
TCTCNTATTTGCTCGAANGNTTTCTGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es