Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14391A5
Clone ID IST14391A5
Vector VICTR74
Project tigm

Sequence tag IST14391A5HMR1
Sequence
AGGGAGCCTGCATGGTCTAACGTAAGCCCTCTGCGAATGTTACAGTTGTGTAACTGTGTTTCTGTGGGATTCCTAACAGA
GGGAATGGAGGCTGTTTCTGATGCTTTTGCCTGCTTTGGGAACCCTTGTCTTCCTAACTGGGTTGCCCCGTCCAGCCTTA
ATATGAGGGGAGGTGCCTANTTGCTGTTGTTGTCTTTAANATTTATTTATTTATTTTGTGTGTTATNANTGCNCANTANC
TN
Sequence Type genomic DNA
Unitrap ID UNI30729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26642082..26642322 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST14391A5HMF1
Sequence
CCCTCATTGTCAGCTCAGACTCTGAGTCCCTATGAGCCCTGGTTGATGCTGTGGGGTTCTTGACCTCTCTGGCTCCTACA
ACCCCAGAAGGATGCTTCTTAGGGTACAAAGAGAACTGAGCCTATCCTGACATGAATCAGGGGTAACAGGTCTCAACTGG
GCTTAAATCCATAATATGGCTTGTTCCCCAATGGGTACCTTTGAGAGGTGAAGAGCCCTTTGAGAGACAGCCCTCCTGGG
AGGGTTTAAGTCANCTGGGGACATGCCCTTGAAGAGGATTACAGCGATCCAGTCTTACACCCCTCTCCACCCTTTCTGTT
CCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26641759..26642085 325
NO GENE  

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es