Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13901H7
Clone ID IST13901H7
Vector VICTR74
Project tigm

Sequence tag IST13901H7HMF2
Sequence
GTCAGCAACCTCCACCAAACATGATGGAGGAAAGCGTGAATGTTGTCACTATGACGGAAGTTCANCTTTAGTCCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7817585..7817663 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST13901H7BBF1
Sequence
ATCCCTACACCTGGGATTAAAACAAGGGCACATTCCTTTAATATTTGTGTTTTTTTTTTCCCCCCAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90094191..90094258 66
NO GENE  

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es