Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14760-NR
Clone ID PST14760-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14760-NR
Sequence
AATTTAGTAAATAAAGATTACTGTGGTGGTGATTTACCCAAATTAGGTTGCAGTACTAGACCTATGAAGATCCTTTACAA
ATAAATTTGGACTCTGGATCTGACTCTTACCAGCTCTTTACCTGGAAACACTTAAGTACAATCATTAAGTATTTTAAAAT
AATCCTTGTTCGAATGTACTTTACACGTTTGCCGTGGGACAGGATGAGTAGTATTAAATTAGGGGGAATCGCTTTTTCAG
GACTGCCTCCGAGTGGAAGCTGGCAGGACTTAAAGGATCA
Sequence Type genomic DNA
Unitrap ID UNI14739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87862306..87862584 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018379 (Sfrs1) NM_173374 splicing factor, arginine/serine-rich 1 (ASF/SF2) Gene [Source:MGI (curated);Acc:Sfrs1-001]

 
Come back to gene ENSMUSG00000018379


For any suggestions or comments, please send an email to unitrap@crg.es