Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13678E8
Clone ID IST13678E8
Vector VICTR74
Project tigm

Sequence tag IST13678E8BBF1
Sequence
ACTATATAGAGACTACCCATAAGTTCTGTGACTCTAGAGAGCCCTGATTAATACACAGGACTTGCCTCTCAGCTCTGCTG
CTGCTGTGGGAAAGCAGCTTCAGACAAGTGAGCCCTGTTGAAGGGACAGACAGGACTGAGTTGCCAGTTGATCAGTGACT
TTTGTTGACACTGTATCAGTGACTTGTCACTGCATCAACTTCCCTAGGGTAAGTTGGATTTAGGCTGAATAACGTGTTTC
TTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI33252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147528589..147528841 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029001 (Fbxo44) NM_173401 F-box protein 44 Gene [Source:MGI (curated);Acc:Fbxo44-001]

 
Come back to gene ENSMUSG00000029001


For any suggestions or comments, please send an email to unitrap@crg.es