Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14512B10
Clone ID IST14512B10
Vector VICTR74
Project tigm

Sequence tag IST14512B10HMR1
Sequence
NCAACCTGTGCAAGCAGGCATGGCANANGGGAGTGTGGCANGGGCAGGGACCTCAAGCAATCTCCAGAATCAGGATGGGG
AAGGGTTACCCCAGGGTGCGATTGGCATTGGGTGGTCCAACTGCCCAAGTTACAGTGTCCTTTCTGTTCCATGGGACTTT
CCCATTCTGGAGCAGGCTGTGGTTCTGTGATGCTGAGGTAATAGCANATGTGGAGTGAAGTGGGAAACCNNCCANATCTG
TAATN
Sequence Type genomic DNA
Unitrap ID UNI13974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25164872..25165114 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es