Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14717-NR
Clone ID PST14717-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14717-NR
Sequence
AGGGAGGCTGAGGCAGCAGGGTCACCAATTTCAGGTCAGCTTGTGCTACACAGCAAGACCCTGTCTCAAAAGAACAAAAG
AAAAAGAAATGCAGGCTAGAGGCTGGGGTGGTGCCGAGGTCAAGAGCATTAAGAGAGGACCTGGCTGGGTCCCAGCACCT
ATATGGTGGCTCACAAGTGTCTGTAACCTCCAGTTCCTGGGGATTCACACCTGTCTTCTGCATCCACGGGCAACAGACAT
GC
Sequence Type genomic DNA
Unitrap ID UNI6526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264542..86264781 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es