Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14692-NR
Clone ID PST14692-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14692-NR
Sequence
ATGCCATGTCTGATGGTCATCTACTGACCATGAGACCCATAGCCACTCACAGTCTGCTGGCTGGCTGTGTTTGCTCTGCC
TCAAGCTCCCAGCTTTCAGCCATTGTTCATGGCCAAGTCCCCAGGGGCTGTGGAGAGAGCCGAAAAAGACATGGTTTGGC
CGTCTGTGAGTTCTTCTGAGGCCCTGGAAGCA
Sequence Type genomic DNA
Unitrap ID UNI14800

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104167357..104167546 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es