Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11481E10
Clone ID IST11481E10
Vector VICTR76
Project tigm

Sequence tag IST11481E10HMF1
Sequence
CTTGTTACCCCTGGCAACTGCTCATTTACTGTTTGTCTATTGATTTGCCTGCTCTGGGGCATTTAATGTTAATGCGATCA
TTCAGTACGTGTGGTCCTGCAGGCCTTTCACTTAACATGATGTTTTCAGGTTTCTTCATATTGTTACTATACTATTTTAT
GCTGAGTANTATTGTGTTGTGTGGGTTATATCACCAGGTAAGGGATTTTTACATTAACATAAACATGAAGCTTATGANTA
NTGCAGCTGTGGTCTATAACANGATGGAATTTGGGGTTATGCANTAACTAANTTA
Sequence Type genomic DNA
Unitrap ID UNI26294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121498181..121498474 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]


Sequence tag IST11481E10BBF1
Sequence
CTTGTTACCCCTGGCAACTGCTCATTTACTGTTTGTCTATTGATTTGCCTGCTCTGGGGCATTTAATGTTAATGCGATCA
TTCANTACGTGTGGTCCTGCAGGCCTTTCACTTAACATGATGTTTTCAGGTTTCTTCATATTGTTACTATACTATTTTAT
GCTGAGTANTATTGTGTTGTGTGGGTTATATCACCNNGTAAGGGATTTTTACATTAACATAAACATGAANCTTATGANTA
NTGCAGCTGTGGTCTATAACANGATGGAATTTGGGGTTATGCANTAACTAANTTGACATTCTTTTCAAATAAATGGCATT
TATCCNTGTGTCANTTTATTGGCTTTAATATCTGTACTATTANTATGGTTTTGAATGTAATTCTTATACCTANTATGTAT
NACTATATANGCTATTATATAAAGTTNAATTTGCTTTCCTTTTCTTCCNNAAAATTATNTCNNGAATTGNCNNATAAGCN
TNANAGTGATTATTACCCTGNTNCATCCTTTAANCCCCACCCGNTTNTNTNTNTCTTGGNNNGNCTGTCTNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es