Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13896A9
Clone ID IST13896A9
Vector VICTR74
Project tigm

Sequence tag IST13896A9BBF1
Sequence
NACGCTGCCTGGTGAGGGAGGGCAGGGTGTTGGTTTGTACATGTGCACCTACACACACACACACACACACACACACACAC
ACACACNCNNTT
Sequence Type genomic DNA
Unitrap ID UNI31132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95486058..95486142 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST13896A9HMF1
Sequence
CGCTGCCTGGTGAGGGAGGGCAGGGTGTTGGTTTGTACATGTGCNCCTACACACACACACACACACNCCCNCACACACAC
ACACNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es