Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10123H2
Clone ID IST10123H2
Vector VICTR76
Project tigm

Sequence tag IST10123H2HMF1
Sequence
GATATGGTATAAACAGAGGCAGCTGTGGGCATTACAAACATGAATAAAAAGCCTCAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107769582..107769637 56
NO GENE  


Sequence tag IST10123H2BBR1
Sequence
ATCTATGTAAACTCTTAACAGTAGACCTTTCTGGGAGACATAGGCAGTTTTACTCTCCAGAATCTCCCCAACACCTAGCA
CAGTGTTCTAGCCCATGGTAGGTAATGAAGAACGACTAGGTAACCTGAGCATGTGTCACACTGCCCGTATAATCATAGCG
CCGATAGCAGAGGCACAGGATCAGGATTTCAAGGTCATCCTTGACTCCTTTGCAAGTTTGAGGCCACCTCGGGTTATGTG
AGATCC
Sequence Type genomic DNA
Unitrap ID UNI71

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107769635..107769879 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


Sequence tag IST10123H2BBF1
Sequence
GATATGGTATAAACAGAGGCAGCTGTGGGCATTACAAACATGAATAAAAAGCCTCAGACTTGTGGTCCTTCTGTCCCAGC
CTCCAGAGTGCTAGGGTTAAAGGCATGTAGTACCACACCATGACAACATCAATTGTACCCTCAAGACCACTTTTCCAGAA
GAGTCACAATGACATATGTGTTGGTTCACTTCTTAACCCTACAGAAAGTCTGACAGTATCTCCAACCCAGGGAATAAGAG
TGTTATCATTTGCGCCGGGTGTGGTGGCTCACGCCTTTAATCCCAGCATTTGAGAGGCAGAGGCAGGCGGATTTCTGAGT
TCGAGGCCAGCCTGGTCTGCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTTGAAAAATCAAAAAAAAA
AAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107769233..107769637 405
NO GENE  

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es