Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10347D2
Clone ID IST10347D2
Vector VICTR76
Project tigm

Sequence tag IST10347D2HMF1
Sequence
ACAGTGCCCGGGCACCGAGNCAGGTGGGCGTGGCCTGTGAGGGAGACAAGGGCTCAAGCTCTTGGTGTAAATATGGGGAT
TGGAAAGAGGATACGTTTANACTAAGGATTGGGTTAGTGGTGCAGCCGGGACAAGAGTGAGCCATCAGCCACCANGCGGG
CATCAGTGGGCATGAAGCTGAGAAGTGGGTGCTGACAGGCCTGGGCTTTAGCACCTGGTAGGAGGCTACAGCCAGTGAAC
TCAN
Sequence Type genomic DNA
Unitrap ID UNI11251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28095320..28095562 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es