Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12835E3
Clone ID IST12835E3
Vector VICTR76
Project tigm

Sequence tag IST12835E3HMF1
Sequence
CCTAAAACCAGATTCTTACTTCCTTGTCCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI34605 UNI34606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 33073055..33073087 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071344 (AC109214.6)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 77390358..77390390 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 95846152..95846184 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29718789..29718821 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 39067859..39067891 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129061081..129061113 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 129466579..129466611 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 60403816..60403848 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 161599619..161599651 33
NO GENE  

 
Come back to gene ENSMUSG00000042203


For any suggestions or comments, please send an email to unitrap@crg.es