Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10990F2
Clone ID IST10990F2
Vector VICTR76
Project tigm

Sequence tag IST10990F2BBF1
Sequence
CNANGACTTGGCGGGGTTTTGGGACATGCTGCAGTTGTCCATAGAGAATATTAGTATGAAATTTGATGAACTTCATCAGC
TAAAGGCCAATAATTGGAAACAGATGGATCT

Sequence Type genomic DNA
Unitrap ID UNI32100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71164567..71164672 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


Sequence tag IST10990F2HMF2
Sequence
GAGACCAGCCTGGTCTACAGAGCAAGCTCCAAGATANTACGGGGATACAGAGAAACCCTGTCTGGAAAAACCNAAAGTAA
CNNAACAAACAAACAAAAACCACAGACAAAACAGCCTGTCTCTAAAGACGCCATCTTCTGCGGTGCTGGGAATTANGACT
TCAGTGCAGGGATTTTTTTTTTTTA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7332990..7333173 174
NO GENE  

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es