Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10472A5
Clone ID IST10472A5
Vector VICTR76
Project tigm

Sequence tag IST10472A5HMR1
Sequence
ACCCAGCANNCNAACCCTTGTACCTAAAGGACTCANCGGTCCTTATTAGTGCTCACCCAANACTCAAATTCAATAAACAG
AAACACTCTTCTCATTTCATCCCAAAAGCGAGGGGAGAACTACATCTAAAATTATTTTATTGTTATTGTTTTTGACATTT
TAGGTTTTGTTTTTGAGACAGACACCTGACTGGCCTGGAACTCACTGTGTAGACCAGGTTAGCTCTGGACTCANATCCAC
CTGCCACTGCCTTCCNAGC
Sequence Type genomic DNA
Unitrap ID UNI18914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153170055..153170312 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073236 (2500004C02Rik) RIKEN cDNA 2500004C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919576]


Sequence tag IST10472A5HMF1
Sequence
GGGTGATTTCTTCGTCTCAGCACTGGCTGCCTGTGTACTAACACCACAAGAGTACAGGGTGTTTTTTTACCCACATAAAC
CTTTCAAAAACTGTAAAACCTGGAACGCCATCAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153170309..153170411 103
NO GENE  

 
Come back to gene ENSMUSG00000073236


For any suggestions or comments, please send an email to unitrap@crg.es