Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14277-NR
Clone ID PST14277-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14277-NR
Sequence
ATGCAAGCAATTCAATAATCAGGTTTGACCTGGCTGCTTGCTATAGTGAAAATAAATCCACTGTATATTTGATAATTACT
TGTTGAATTGTTCCTTGGTGAAACTTTTATACTTAGGGATTTGCAGTTATTTAAATTATTACACATTGTTATAATGACTA
AGAGGTAACCATTGCATG
Sequence Type genomic DNA
Unitrap ID UNI14810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100391667..100391844 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es