Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0350
Clone ID XT0350
Vector pGT0lxf
Project sanger

Sequence tag XT0350
Sequence
TTTTTGATCTCATTCAGTGTGTGTGCACTTCTTCAGCCCTTCCAAGTGGCAAGGCCCAGCCTCATGCCTCAGTAGTGTAT
TCTGAGGCTGGGAAAGATAAAGGGCCTCCTCCAAAATCCAGATATGAGGAAGAGCTAAGGACCCGAGGGAAGACTACCAT
TACTGCAGCTAACTTCATAGACGTGATCATCACCCGGCAAATTGCCTCGGACAAGGATGCGAGGGAACGTGGCTCTCAAA
GTTCAGACTCTTCTAGTAGCTTGTCTTCTCACAGGTATGAAACGGCTAGTGATGCCATTGAGGTGATAAGTCCCGCCAGC
CCACCTGCACCACCCCAGGAAAAGCCACACGCCTATCAGCCAGACATGGTTAAGGCAAATCAAGCAGAAAATGAGTCCAC
TCGACAGTATGAAGGTCCACTGCATCATTATCGGTCCCAGCAGGAATCACCATCTCCACAGCAACAGCCACCACTGCCCC
CATCTTCATGGGAAGAGGAACCGAAA
Sequence Type mRNA
Unitrap ID UNI2493

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62143534..62147419 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es