Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050A3
Clone ID IST15050A3
Vector VICTR80
Project tigm

Sequence tag IST15050A3HMR1
Sequence
AAACGAGTCCTACTATATAGTAACTAACAAAAGAAATTTACTCTTAAGGTGAATTGTACAGGACCCCCAACCCTGCTCAC
TTTCTTTGTGCAGTATTCATTAGTTTATTTTTATAAAAAGATGATTAAATAAAACTGATAATTGACTGAGTCATTTTAGC
TTAAATATACGACCGTAATAATTTTCCACAGAAGGAAATGCTCTCTGTGATATGCCTTTTCACTAGAAAATTTTGCATAT
TAATATGGTTTTTTTTCCTAGTCTGATTANATTATGGATAACTTTCAGCAAGTGTTTTGAGTATTCAACTTTTATGTCNG
ANAAAGAAATTTCTGAAAAACATGAAAAT
Sequence Type genomic DNA
Unitrap ID UNI25742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76328797..76329145 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST15050A3HMF1
Sequence
GTTTCTTGAAAGACCTGAGCTCACACATATGGAAAAACCAGTACAGGACATTAAGAGTTTCATATGTGTTCCATGTTTTA
TATTGCTTTCAATATTTAATAATCTAATTGTTTCTTCAGTCCTCTTCTTCATTCAAAAAACATCACCATCCTACAAAGCT
TAACGCTGGTTTCTTTAGTGTGGTTGTGTAACAAACTGTGATAAAAAAGGCTTATTATAAATAACTTCAACTTGTCAAAC
ACTGTTTACCACACATTCCTTAGGATAGTACCTACACACACACACACACACACACACACACACNNNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76329142..76329444 303
 
EST/CDNA Est Name
  AW047215.1 - CJ128064.1

 
Come back to gene AW047215.1 - CJ128064.1


For any suggestions or comments, please send an email to unitrap@crg.es