Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12255C12
Clone ID IST12255C12
Vector VICTR76
Project tigm

Sequence tag IST12255C12BBF1
Sequence
GAACATAATCTTGAATGACCGCAACATCGAGTGAGAGAAATTAGTGTGTGTTGGAGAGCTGGAGCCGGCGGCCCTCTTGG
CTCTCCCCCGATTTGGTTAGCAGCTTCTCAGTCACGGAAGGGGCAGCAGGCCGTTCCCTTGGGGCAGCAGGCCGTTCCCT
TGGGGCAGCAGGCCGTTGCCTTGGTGGGGTAGTTCAGGAATGTGCCCTTGGAAGTGGTTCCTGGAAGTCCAGCCCACGCC
TCTTTCCCACCTTTCCCAGGACTCTGCAAGCTCTGTAAGCTTATTGTTGGGGAGTGGGAGGAGTGGATGAATTCCAAGGC
TTGTGGTTTCTGACCCTTGGTCACTTCCATTTCTCCAAAATAAGTTGCAGAGTGATTTCATTGTTGTTCCNAACAGAGTT
NTTTAAAAAGTTNTGACCTTGTTTATCNNTNATATATTCNAGTAANAATAAAGTCTN
Sequence Type genomic DNA
Unitrap ID UNI17458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91279382..91279837 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]


Sequence tag IST12255C12HMF1
Sequence
GAACATAATCTTGAATGACCGCAACATCGAGTGAGAGAAATTAGTGTGTGTTGGAGAGCTGGAGCCGGCGGCCCTCTTGG
CTCTCCCCCGATTTGGTTAGCAGCTTCTCAGTCACGGAAGGGGCAGCAGGCCGTTCCCTTGGGGCAGCAGGCCGTTCCCT
TGGGGCAGCAGGCCGTTGCCTTGGTGGGGTAGTTCAGGAATGTGCCCTTGGAAGTGGTTCCTGGAAGTCCAGCCCACGCC
TCTTTCCCACCTTTCCCAGGACTCTGCAAGCTCTGTAAGCTTATTGTTGGGGAGTGGGAGGAGTGGATGAATTCCAAGGC
TTGTGGTTTCTGACCCTTGGTCACTTCCATTTCTCCAAAATAAGTTGCAGAGTGATTTCATTGTTGTTCCAAACAGAGTT
TTTTAAAAAGTTTTGACCTTGTTTATCATTTATATATTCNAGTAATAATAAAGTCNTTTCAAGTTTCTGTCCNAAAGTTG
GCAGCCATTTTTTTTTTCTTACATACAGCATCTGCTTNNGGAAGTGGANTAGGTNACTGN
Sequence Type genomic DNA
Unitrap ID UNI17458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91279302..91279837 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]

 
Come back to gene ENSMUSG00000040591


For any suggestions or comments, please send an email to unitrap@crg.es