Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14885F7
Clone ID IST14885F7
Vector VICTR76
Project tigm

Sequence tag IST14885F7HMR1
Sequence
TATGTCNGAGCCTTGGTAAATCGAGAAAATATAATGAGCTCATAAGTATCAGTAATAGAGATTTAAGAACTATAGTANAG
TTGCTACATAGTTTTCAGAAGGGAAAAACTTACTCTAGAATGAATACGTAGACTCCAGGATTTTAGTTGCTCACGGTTGG
TTTCTAGGCTCACTGCTATTCATTANCATTCTACNCGTCTCATTGGTTTCATTAAACCATCAATTCN
Sequence Type genomic DNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21748319..21748544 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]


Sequence tag IST14885F7HMF1
Sequence
ATAGATTACTACCAAACAAGCGCCTGGTTTTAAGAGTGATGGCTTTTCTTTCCCTCTCAGGTACAGTGTTGCTTGGTAGT
CCAGGTTGGTTGCCACTTGGCAAATACGAGGATTACGAGCATACACTACAATATCTAATGGATAGCAATCTTTTCAAGGA
TAACTTTTTCCATAAAAAAAAAATTNANNNGNNNTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21748137..21748321 185
NO GENE  


Sequence tag IST14885F7BBF1
Sequence
ATAGATTACTACCAAACAAGCGCCTGGTTTTAAGAGTGATGGCTTTTCTTTCCCTCTCAGGTACAGTGTTGCTTGGTAGT
CCAGGTTGGTTGCCACTTGGCAAATACGAGGATTACGAGCATACACTACAATATCTAATGGATAGCAATCTTTTCAAGGA
TAACTTTTTCCATAAAAAAAAAATTAAAATGTNTTCCNCANAAATTAAAANTCNGGGTGCTGAAAAAATGGCTCTGAGGC
TGAAANCNCAAANTGTTCTCTCAATCCCAGGGAANCAGGGTTNAACCCCNNCACTNNNNANAACAACNCANNTGCCTGTA
ANANNNNTGCCNNTGGATCTGAANCCAANCCCTCATGTGGTGCNCANTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es