Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12404G5
Clone ID IST12404G5
Vector VICTR76
Project tigm

Sequence tag IST12404G5BBF1
Sequence
GACCCTGTCTCAAGGAATTAATTGAAGTAAATGTGAGCAGTGAATAGTAAATTCAAAATAAAGGTTCTCCATGCTACTTC
TAAAGGATAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI34252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41302329..41302425 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075225 (5033413D22Rik) NM_029493 RIKEN cDNA 5033413D22 gene Gene [Source:MGI Symbol;Acc:MGI:1923223]


Sequence tag IST12404G5HMF1
Sequence
NACCCTGTCTCAAGGAATTAATTGAAGTAAATGTGAGCAGTGAATANTAAATTCAAAATAAAGGTTCTCCATGCTACTTC
TAAAGGATAGAGATCTGATTCCCTGAACTGGAGTTATAAGCAGTTGTCANCCAGGCAGGTAAAACCGANTTCTGCTTTCT
GATTCATAAGATGGGTAAACTCTACTCTCCAAAGAAAAGTTACCTTACAGCTCCNCCATANACTANAGGGTANGGACGAC
TTCNGTCTCANNTATGTTTAACGTCTTTCTTTTCTCTGTTTCTGTCTCTCTGTCTCTCTGTTTCTGTCTCTCTGTCTCTC
TGTCNCNCTCTCTCTTAN
Sequence Type genomic DNA
Unitrap ID UNI34252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41302089..41302424 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075225 (5033413D22Rik) NM_029493 RIKEN cDNA 5033413D22 gene Gene [Source:MGI Symbol;Acc:MGI:1923223]

 
Come back to gene ENSMUSG00000075225


For any suggestions or comments, please send an email to unitrap@crg.es