Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14215F10
Clone ID IST14215F10
Vector VICTR74
Project tigm

Sequence tag IST14215F10HMF1
Sequence
ATTTNAGTCTATCACCTAAAATCNCCTATTCTAGTCATTCTCCAAAAACTGTCCTCTTCCNCCACCATCTTTGTATTTAG
AAGTTATCGACCAAGTTTTCCTTCCTTTCCAGTCNGTCATATCCCACAACTACATACAACCCAAAACAGTCTGTTGCTCA
ATGACACAAGTACTGACCGTATTATCTAACACTTCTAAGTCNTTTTAACCTTTGTGCTTGATAGAAATCTATAAAGTATG
GGCAACCGANTTACATTTCAATTTTCTTTACTTTGTNAATTTNCTGANTAAGANNGTTTTGGTCATTCNAACTAGACAGG
AAGCTTCTGCAAACAAGAACTACTTCTCATTGTATTNAGANTTTCTTTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11707414..11707782 341
 
EST/CDNA Est Name
  BB650464.1 - CN682555.1 - BB864589.1 - CK392148.1 - BY027904.1 - BY025302.1 - BY025899.1 - BY231020.1 - BY026616.1 - CN679237.1 - BB860545.1 - CJ096402.1 - CJ076713.1 - BY062179.1 - BY034169.1 - CF167601.1 - CJ088653.1 - BY071307.1 - CJ075899.1 - BB842295


Sequence tag IST14215F10BBF1
Sequence
NTTNNGNNNNANNACCTANNNNNNNNANTCNNGTNNNNNNNNNNNNCNGNCCNNNNNNNCNCCATCTTTGTATTTAGAAG
TNATCGACNAAGTTTTCCTTCCTTTCCAGTCAGTCNTATCCCACAACTACNTACAACCCAAAACAGTCTGTTGCTCAATG
ACACANGTACTGACCGTATTATCTAACACTTCTAAGTCATTTTAACCTTTGNGCTNGATAGAAATCTATAAAGTATGGGC
AACCGAGTTACATTTCANTTTTCTTTACTTTGNNAATTTTCTGANNAANAATGNTTTGGNCATTCNNACTANACNGGAAN
CTTCTGCNNACANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14215F10HMR1
Sequence
AATGAAGCTATAAAGATAATTATAATCNTTGCGAACCTTTGTGGAGGATATTTTCCAAGTTACTTCTCCTTCAGGTTCTT
TTTTTTTTNNAA
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11707329..11707416 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es