Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12064A3
Clone ID IST12064A3
Vector VICTR76
Project tigm

Sequence tag IST12064A3HMF1
Sequence
GACTACAGATTAACTAATAGGCACAATCAGCTTCTCTAGTCTCCAAGTTCTCGTGCTGGTTGAGAGTCCCATAGTTGGTA
TCTATGCAGAACTGCGGTCCCATCCTTATAGCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131829882..131829994 113
NO GENE  


Sequence tag IST12064A3BBF1
Sequence
GACTACAGATTAACTAATAGGCACAATCAGCTTCTCTAGTCTCCAAGTTCTCGTGCTGGTTGAGAGTCCCATAGTTGGTA
TCTATGCAGAACTGCGGTCCCATCCTTATAGCACCACAAAGGCACCAACCAAAAATGGCGACTTGGAAGCTCTCCGAGGC
CGTCGGTTACCGGTCACGCTCGTGAAAGAGATGAGTCGTAAAGAAACATCTAGGACAGGGATTCACGCCGTGGTAGGGGA
CGCAGAGTAGACCCACGCCACCAGCAAGCCACACAGAGCAGAAAGCCCGACCTGCCAAGCCAGGCGCTGGGCTCACAGTC
CTACCACGTGTTGTAGTACNNTCTGCGCCTGCGCTAGTGAGGCGCGCGCCCGGCGGCCGGAAGAGCCGCGCGTTTCCGGG
TTGGAGGCGGGGAGCGGTGCCGGAAGTGCTTGGGGANGGCCGCGCANTNNNACCGGCTGCTGANACNAAAGCTTCACTGN
NGCAGTCTNCNGCATATNNTGGGGAGATANACNCTGCTGCCTGTGANTCTTGGGCCN
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131829882..131830416 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es