Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12136-NL
Clone ID PST12136-NL
Vector U3NeoSV1
Project escells

Sequence tag PST12136-NL
Sequence
TTGAAAAATGAACTTAAATACATTTCTTTTTTAAAACTCATTTTTGTTTTGCTTGTGTGTTTATTGTTTTGAGATAGGGT
TTATCTGTGTAGCCTTGGCTGTCCTGGAACTCAGTATGTAGTCTAGGCTGGCCTCAGAACTCACAGAGAGATCTGCCTGC
CTTTGTCTCCCTAGTGTGCCACCATGTTTGACC
Sequence Type genomic DNA
Unitrap ID UNI14812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34640901..34641093 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036572 (Upf3b) NM_026573 UPF3 regulator of nonsense transcripts homolog B (yeast) Gene [Source:MGI (curated);Acc:Upf3b-001]

 
Come back to gene ENSMUSG00000036572


For any suggestions or comments, please send an email to unitrap@crg.es