Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13614C8
Clone ID IST13614C8
Vector VICTR74
Project tigm

Sequence tag IST13614C8HMR1
Sequence
NCCNNNATACNNNNTTTTNTGGNTGAAAACTTGGNANTTTTCTACTTCGGATTGCCTTACTATAAAATTAGAATTTTCCA
AGGAATGGAGTATACTGATGCCTGGGTGTANACTACTTGTTTGGGGTTTGCATCCCTTCTCATCTTGATTCTCCTGTTCA
TTGCCAGGACAGGGGCACAAATACTGCTTAAATCCCCAAAACAATGCACAATGCTTAAATTTACCAAACTTTTTTTCAGA
CCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI11918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37106655..37106891 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  


Sequence tag IST13614C8HMF1
Sequence
NGTGGAGGGCATANANACTCANCACCACTTANNTCANACCTCCAAAAATATTGGGTGTGANCAGANAACCTANCATAAGG
GAGGCCATANTTCACAACGGGCTGGAGGTTGAAGGAAGTGGCTATTGGTTATTTCAGGAATCTTCTATCTTATTCTCTTG
ANANACTCTGAACTGTCCTGAAANAAGGGTGANCCCTGGGACANCTACTCNCTGGTGCTGGGTCNNGANNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es