Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10078F10
Clone ID IST10078F10
Vector VICTR75
Project tigm

Sequence tag IST10078F10BBR1
Sequence
ATTTCGTGAGTTATTTATTTTTTCCTTGAAGGACTCTAATATCTTCATGAGATAGGATTTTTGGTTAGCTTCCTGATTTT
CAGGTGTGTTGGTGTATTCAGGACTTGCTGTGGTGGGAGAACTGGGTTCTGATGATACCCACACATATTGGCTTCTGTTG
TTTACGGTCATGTGCTTGCCTCCCACCATCTGGTCATCCCTGGTTTTTGCTGATCTGGGTGTTTCTGTCTGGAGCCTGCC
TCTTTTGTCCCTGGATTGCTTCAGGTCTCCTGGTAGGCCTGCGACCCTGGCTGTTGCAGACCTCCTGTGGGGCCTTCTGA
TTGTGGGGTCTTCAGAGGGGCATAGAAGCTGCTGATCTGTTGCCATGACTGCAGCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI34617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81742317..81742697 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069170 (Gpr98) NM_054053 G protein-coupled receptor 98 Gene [Source:MGI Symbol;Acc:MGI:1274784]

 
Come back to gene ENSMUSG00000069170


For any suggestions or comments, please send an email to unitrap@crg.es