Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12630D10
Clone ID IST12630D10
Vector VICTR76
Project tigm

Sequence tag IST12630D10HMF1
Sequence
TTCTAAACTAGTGAGCTGTCTCTTCAGCTAACCACTATGAANAANTGAANANAGCCANATGGTGGAGGAACCTTTAATCC
CAGCACTCGGGAGGCANAGGCAGGCGGATTTCTGANTTCNAGGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12630D10BBF1
Sequence
GTCCCCGCTTTGAAGCTTTTCAGTGGTCTGCTAGCTCCAGGATTCTCTCGCTGTGTGATGACGACAGATCGCTGCCAAGA
AGCCAGGGACCCCTGTGCTGCCCCACAGTGGGCGCTTCCCACTGCTGACATCTCAGGACTCTGAGCCAGGACCCAGGAGG
ACAGGGCAGCTCAGCATCTGAACCCCATTTCCCAGCCCCCAGCACATGCTTCTCTGGAGAACTGGGCCAGGGGAANCCGG
CTTCCAGAGGGTGGGGCTGCATGGTCATCAGGGTGGAGTTGTTTTAGGAGGTGTCCCACGCACACTGCCTGAGTTTGTCA
TGAGGCCNANAAGGCCTGGGCTAAGGGACACCCCCAGGTCATTTACCCAGCANTGGCANCTAGGAGGGGTTGCTCTGCAN
TGTGANCTGCCNCCATTGTCNTGTGGCNAANCCTCAAGGTGANACAAGCCAGGGCACANCCCTGCTGTNNNATCACTCCC
CTGCGCN
Sequence Type genomic DNA
Unitrap ID UNI17332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115125175..115125659 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011884 (Gltp) NM_019821 glycolipid transfer protein Gene [Source:MGI (curated);Acc:Gltp-001]

 
Come back to gene ENSMUSG00000011884


For any suggestions or comments, please send an email to unitrap@crg.es