Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10818E10
Clone ID IST10818E10
Vector VICTR76
Project tigm

Sequence tag IST10818E10HMF1
Sequence
NCTTAAGTAATCCTTTGTGAGAATCATCATCACTATGTGGCTGAGGAAGGAAAAGACTGGAATCTCTAAAGCAAATATAC
TTCTGTGTGGAGCGGTACGTGCTGCACCAATAGGAAGTAATTTCTAAAAGGTAAATATCCACAAATATGAAGCACAGAAT
TTAAAAATGCAGCATACNNGGCTCAAAATGTGTANTACTTTTATGTGCACACCANTGTAAGACCNNACAGTGAGGTCTGC
AAGAAAATGGGCCANAACCAAGTGCAGGGCTTCCCTGANAGACCTCTGGGTCTATCACTGTCCTGAAATGTGGCTGCACA
CAAGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86635244..86635570 311
NO GENE  


Sequence tag IST10818E10HMR1
Sequence
AAACAGGCCTTATGGGTAAAAGTTAGCATGCCATTTATTCTGCAAGTTCAAG
Sequence Type genomic DNA
Unitrap ID UNI3481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 144630553..144630605 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031068 (Glrx3) NM_023140 glutaredoxin 3 Gene [Source:MGI Symbol;Acc:MGI:1353653]

 
Come back to gene ENSMUSG00000031068


For any suggestions or comments, please send an email to unitrap@crg.es