Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14894B3
Clone ID IST14894B3
Vector VICTR76
Project tigm

Sequence tag IST14894B3HMF1
Sequence
GTGGGTGCTAGGAATTAAACCACGATCCTCTGTAAGATAAGCCAGTCCTCGTAACCACGGAGCTCTCTCTCCAGTCCCCT
TTCATTTTAGTCTATGTAACTATTTTGAGACAAGTTCTCATAGCCCAAGCTGGCCTTGAACTTGCTATGTAGCCCCAGGC
TGGTCTCTAACGCAATGATTCTCCTACTTCAGTCTCAGGAGTGCTGGGATTGCAAAGGAACATCACCATACCCAGCATTT
CTCTCACTCTCTCTTTTAACGTGCTGGGAAGAAAGGGGTATGACAGAAGACAGCTCACTGACCTTGCATCTCCTGAGCCA
GTTGGGACCCGCGCCATTTTTCACTANCCACANTATGTCCTAGTGGCACGTGGACCGGANCGGTCCCATCNGGCGGGTTC
CTTTCNNNNNNTGGTTTTNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36180930..36181347 398
 
EST/CDNA Est Name
  AK031566.1


Sequence tag IST14894B3HMR1
Sequence
CCCACATGGTGGCTCAAGGAGTCNGACTCCTCCCTCTTCTGGCCTTTGGGGGCACTAGGCTTGCACATGTGCACAGACAT
ATGCNAGCAAAACCTACATATAAATCTTTGGGTTTTATTTTATTAAAAAGGAGGTTTAGGACAGGTGGTGGTGGGTCACA
CCN
Sequence Type genomic DNA
Unitrap ID UNI34618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36180773..36180934 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030493 (C230052I12Rik) NP_848758 RIKEN cDNA C230052I12 gene Gene [Source:MGI Symbol;Acc:MGI:2142208]

 
Come back to gene ENSMUSG00000030493


For any suggestions or comments, please send an email to unitrap@crg.es