Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11402C8
Clone ID IST11402C8
Vector VICTR76
Project tigm

Sequence tag IST11402C8HMF1
Sequence
ATTTTATTTTGGTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCAG
Sequence Type genomic DNA
Unitrap ID UNI11078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70792984..70793043 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]

 
Come back to gene ENSMUSG00000018446


For any suggestions or comments, please send an email to unitrap@crg.es