Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12667A10
Clone ID IST12667A10
Vector VICTR76
Project tigm

Sequence tag IST12667A10HMF1
Sequence
AGATCTTCCTGCCGCCGCCTCCCAAGGGTTGAGGCTAAAGGCCAGCTTGAATCTGGACAATTTAGTTTATTTTACCCTGC
TAACCAGTATCTTAGTGTATCTTCATTTGTTTTAACTCTCTCTGCTTCATTGTGAGTAGAGATAGCTGGATATGCTCTCT
GTTGGGTGGGGCGGGGCAGGGCGGGGCGGNNNCN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18144069..18144257 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es