Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9762-NL
Clone ID PST9762-NL
Vector U3NeoSV1
Project escells

Sequence tag PST9762-NL
Sequence
CATGCCTAGCACCAGAGACCCTAGATTCAATATTTGGTACCAAGGGACTAAATAATCCCTGAGTTGGATACCTTGAGATA
CAGACATTGGAAATGTCTCTGCCCTCAGCTCTCCATTGAATTGAGAAAGAAGAAATCACCTCTAAAGTAATCAGTTGTGG
GGCTAGAGAGATGGCTCGGTTAAAGGCACTGGGTTCTCTTCTCAGCAGCTGTCTCTAGCTAT
Sequence Type genomic DNA
Unitrap ID UNI14818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5646021..5646242 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024927 (Rela) NM_009045 v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene [Source:MGI (curated);Acc:Rela-001]

 
Come back to gene ENSMUSG00000024927


For any suggestions or comments, please send an email to unitrap@crg.es