Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14674F10
Clone ID IST14674F10
Vector VICTR74
Project tigm

Sequence tag IST14674F10HMF2
Sequence
CCAANTATGGGCAGACACCCTCTTCTNAACCATANACAGTTTTCCCCAAGACCAAGCAGTCTGTCTAAAGAACAAGCCCT
CTATCCGTTATCCTANACACAGTTTTCATAGTAGCCCACAGAAATGCAACACAATATCAGGGAAAGCTTCCTCTGCCCAT
TTCCATGTGACCAATTTTCAACTTTTCTTCAATTACTAAGGCAACTACACCAGGAACAATGTGAACTTGACCAATGTTAC
CTGTGCTAGTGTGTGTATAGAAATAAAATAAAATCATATTTCATGACTCCAATAAAGATAACTCAAANTCNNCCNNAANN
NGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177052216..177052525 300
 
EST/CDNA Est Name
  CN690235.1


Sequence tag IST14674F10BBF1
Sequence
CCANNTNNGGGCAGACNCCCTCTTCTNAACCNTANACAGTTTTCCCCAAGACCAAGCAGTCTGTCTAAAGAACAAGCCCT
CTATCCGTTATCCTANACACAGTTTTCATANTAGCCCACANAAATGCAACACAATATCAGGGAAAGCTTCCTCTGCCCAT
TTCCATGTGACCAATTTTCAACTTTTCTTCAATTACTAAGGCAACTACACCAGGAACAATGTGAACTTGACCAATGTTAC
CTGTGCTAGTGTGTGTATAGAAATAAAATAAAATCATATTTCATGACTCCAATAAAGATAACTCAAAGTCACCCCTAAAC
TGTTGTAAATTTGACCCTAGTTACTACTGATCTGTCTTCTGAACAGANANGCCCCATGCTTCAGANCCCTCTCTGTCATT
GTAGATGATCAGAAAGTTGAGCTNTTGNTCTATAGCTGNTCNTGACCCTTANTGATTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177356908..177357358 421
 
EST/CDNA Est Name
  CJ050500.1 - BM125820.1 - CN690235.1


Sequence tag IST14674F10HMR1
Sequence
GGNCNNGTGGCAAGAAGGTAAGGGGANATGGAAATAGTCTTC
Sequence Type genomic DNA
Unitrap ID UNI12387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177052158..177052192 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078869 (OTTMUSG00000016577) predicted gene, OTTMUSG00000016577 Gene [Source:MGI Symbol;Acc:MGI:3649811]

 
Come back to gene ENSMUSG00000078869


For any suggestions or comments, please send an email to unitrap@crg.es