Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14501G9
Clone ID IST14501G9
Vector VICTR74
Project tigm

Sequence tag IST14501G9BBF1
Sequence
GTCTAGGTTACAAAAACAAAACAAACCATCAACCCAGANCTGTATTCATGACAGGCAAGCCCTCTGCCAGANCTATAACT
CTGACCCTAGATATTTTAACTCTGGTGGAAACCTCCAGAATGCTCCTTAGATTAAAACAAAACAAAACAAAACAAAACAA
AAACTAAGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCTCTTGGAAGGCAGAGGCAGGAGGATTTCTGANTTCGAG
GNCNGCNNGGTCTACAAAGTGANTTCCANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974221..109974488 252
NO GENE  


Sequence tag IST14501G9HMR1
Sequence
NACTAGCTTTGAACTTGTNATCTCTGGAGTGCTGCTGGAATTACAGGTGTGTGCTACGACATGCAGCCCTTACAGTGTTT
TAGAGGCTGAGTCCTACTGTGTAGCCCATACTGAACTCAGTGTTCCTCCTGTCTTTCAAGCTCTGGGATTATATATACAT
ACCACAGTGCTCAGCTGCGGCGTAATGCTTTAATGGCANCANTTTCACAGTTANCAAAACCCACCTGTCACTCATGTCTC
ACTGTGGTNNCGCTTGCATTGAANGTGCTGCANCCNANACACCATTGGTGCTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974487..109974783 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es