Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243D1
Clone ID IST12243D1
Vector VICTR76
Project tigm

Sequence tag IST12243D1HMF2
Sequence
CCATTCTTTGCCAATTAGAGCCCTTACTTTAACTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI30981 UNI32837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 117887..117926 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079801 (AC125149.4-205)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 170003..170042 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079190 (AC133103.5-205) A530032D15Rik protein [Source:UniProtKB/TrEMBL;Acc:Q52KL8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 78514049..78514088 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37250326..37250365 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 65421796..65421835 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 16806965..16807004 40
NO GENE  


Sequence tag IST12243D1BBF1
Sequence
CCATTCTTTGCCAATTAGAGCCCTTACTTTAACTGTCGACACACTCTGAGGCTGAGACTTGAATTTTCGCTGTAGTTCAG
CCAACCTTACAATGAGAGTTTCTGTTTGATTTTCTGCAACTTGAGCTCTATTGCTACAAGAGAGAAGATTCTCCTCAAGG
ACACACTTAGCAACTTTTAGATCGTTTACTTGTGTCTGGAGCCTTTCGATTTTATCACACAACTCCTTCCTTTCATTCAT
CATTTTTTCCACAGATACTAAGAGCAGCCAGCCAGTAAAATCATTTTTCGATTTTTTCCCCATCTTGTAGAAAGCTTTGT
GCACTGAATCACCTAATTCATTAAGAAAATCAAGGGCATTAGCTTCTTTAAGTTCGGAATATAGTTTCAACCATGGGTCT
TCAAAATTCTCTGANCTCCCAGGANGGAGAGAATCTGGAGAGGTTTCAANAGTTGAAAGTGCTGGTGGATCAACAAGCNN
ANTCCNGNNTTTAAAAGATTCATCCTTGTACTTCTGTTACNNNAN
Sequence Type genomic DNA
Unitrap ID UNI7884 UNI12222 UNI31095 UNI31256 UNI34623 UNI34624 UNI34625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293516..44294036 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 55594735..55595255 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23828330..23828850 499
 
EST/CDNA Est Name
  BI100083.1 - BY763435.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 46981110..46981630 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 30944952..30945472 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022240 (Ctnnd2) NM_008729 catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3025655..3026175 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23451797..23452317 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22528710..22529230 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 59926122..59926642 499
 
EST/CDNA Est Name
  BY513056.1 - AA277029.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25348177..25348697 499
 
EST/CDNA Est Name
  BB653722.1 - BG921852.1 - BG070667.1 - AA549470.1 - AA415829.1 - BY558295.1 - BY563999.1 - AA666828.1 - AA500546.1 - BY572072.1 - AA414956.1 - AA414904.1 - AA415056.1 - AA543194.1 - CJ133058.1 - BP770552.1 - CA584775.1 - CA584547.1 - AA623630.1 - CA871860
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7265326..7265846 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 55221747..55222267 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038022 (C330043M08Rik) NP_808551 RIKEN cDNA C330043M08 gene Gene [Source:MGI Symbol;Acc:MGI:3583959]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30452177..30452697 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67666761..67667281 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037720 (Tmem33) NM_028975 transmembrane protein 33 Gene [Source:MGI (curated);Acc:Tmem33]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 53626331..53626851 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028412 (Slc44a1) NM_133891 solute carrier family 44, member 1 Gene [Source:MGI (curated);Acc:Slc44a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 131596914..131597434 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3275015..3275535 499
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19965590..19966110 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 82423086..82423606 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026142 (Rhbdd1) NM_029777 rhomboid domain containing 1 Gene [Source:MGI (curated);Acc:Rhbdd1-001]

 
Come back to gene ENSMUSG00000026142


For any suggestions or comments, please send an email to unitrap@crg.es