Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10341-NL
Clone ID PST10341-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10341-NL
Sequence
TGCCTATAATCCCAGTACTTTGGGATGTCAATGGCAGAAGGATCACAAGTTCAAAGCCAGCCAGGCTACTAAGACCCTTT
TTAAATAAAAGAATGGAGGGTCAGGAGAGCAGGAGAGAAAAGAGCAGTCACTCTCAAGCAGTGAGGGTCAGGGTCCCGTG
CAGGAGCCACTATACCAGAGCATTAGTGGGCAATGTCAGGAGAGTATTGTGAACCCCCAATGAGGGGAGTGAATCCTTGG
ACATCGTGTGGAAATAAGAAGAAAACTAGCTCAGAGGCCATGTG
Sequence Type genomic DNA
Unitrap ID UNI14821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25356702..25356978 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051768 (Xrcc1) NM_009532 X-ray repair complementing defective repair in Chinese hamster cells 1 Gene [Source:MGI Symbol;Acc:MGI:99137]

 
Come back to gene ENSMUSG00000051768


For any suggestions or comments, please send an email to unitrap@crg.es