Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14840H3
Clone ID IST14840H3
Vector VICTR76
Project tigm

Sequence tag IST14840H3HMR1
Sequence
GTGGCGGTCACAGTTGTTGTGGAAGCCTTACTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713908 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]


Sequence tag IST14840H3BBF1
Sequence
CAAAGAACTNNNGTCTCANNNNNAAACAANCNAAAAAACAAAACANAAACCANCANCCNTAAAANACTTCAAGGGCCAGC
AAGAGCTATATGAAACCTTGCCTCANAAGCAACAACAGCAAAAATAACAAGGGCAAAGTTAAATGAAAAGGGAGGACTAG
GGGAGGCCACAGCAGACACAGAACCCCCTCCCTCGATTGGGAGCCAAGACAGAAGAAGCTGGGCTGAAAGCTAGGCAAGG
GCTGAAGCCCAGGTAAGGACAAAACCATGAAGGTATTAATTACACCTAGGCAGTCCTGAAACAGACAGCTGGAGGTCAGA
GCAACACGGCAAAGCCATGCAGGAAACTAGGAGCAGACAAGAAGGTCATGCCAGCAATGGGACTGAGACATCTGGCCTCC
TGGGTGGGGACTCCAGGTTGGTACTGGAGGGGTGTTCCTTTCCTGGGGAACANGCGGGAAGAGTCNAANGGAGGTGGCAA
TGGCANCTGGCTGGCCNTGCCATGATCANANTGCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es