Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12317A10
Clone ID IST12317A10
Vector VICTR76
Project tigm

Sequence tag IST12317A10HMF1
Sequence
CACTTAGGGAGCACTCTGCAAACCACAGGATTTAGGGAAGGGGGAGGGTCATTTTAAGGTTCCTGCCTGCTTACTGTGAC
TCTTCCTCCAGTTGGTTCATTTTGGAAAAACCACCCAAGCTTCTTTTTTGACTCGGGGTTTTAACGCGCTCCTCGGAGGG
GGCGCGGCGGAGGCTTGCTTTAATTTCCAACATAATCATAAACAGGTTCCAAAGTCTAGCGGGTCATCCTGTGGCCGCCT
TCCTGTA
Sequence Type genomic DNA
Unitrap ID UNI10834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71201856..71202101 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es