Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518H6
Clone ID IST14518H6
Vector VICTR74
Project tigm

Sequence tag IST14518H6HMR1
Sequence
NATCTATNATTTATGTATGTATGTATGCATTATCCATCTATCTATATCTATGTATCTATCTATGCATCTATGCATCTGTG
TATCTATCTATGTATCTATGTATCTATGTATCTATCTATCTATCTATCTATCTATCTATCTATCTACCATCTATCTATAG
TACTATCTTTTTCATGATCTCACACTTCTTANCAGTTTTCTCACAAACCAAAGTGCATGTCTGTGGGCAGTTTTTCTACA
TTATAAATAAACATGAGTATCAATCTGTTCCATACACTTTTGGAAAAACTAATAAAAGTTCTCCACCCTCTNCNTTGANC
CATNANTNANNATTCCACTTANANNNGATTCTTTCTCTGGCTCTCACTATACTCAAATATTCATGTCGGGACTTGCCNNA
NGCTCCCTNAGTTTCTGAANGGACNTNNGTCTCANGAATTTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14518H6BBF1
Sequence
ANNNGANNNNCNGACAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGACAGACA
GACAGACNGAN
Sequence Type genomic DNA
Unitrap ID UNI34632

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17926818..17926895 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 85332686..85332763 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075217 (4833423E24Rik) NM_001081664 RIKEN cDNA 4833423E24 gene Gene [Source:MGI Symbol;Acc:MGI:2687041]

 
Come back to gene ENSMUSG00000075217


For any suggestions or comments, please send an email to unitrap@crg.es