Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0252
Clone ID XT0252
Vector pGT0lxf
Project sanger

Sequence tag XT0252
Sequence
CTCGGGTTTCCATCCCCACCAGCCAGCCCGCCGCGCCCGGATCTCCTACTCCCAGCCCTCTTCCTTCGCTTCCTGTGCCC
TGCCATCATGTCACCCTCGCTCTTCAACCTGCTTCAGGAGTATCCTGACGACCGCACGGCTCGCACCCTCACGCTCATGG
CCAAAGTCACCCAGAACCTGGCCAACTTTGCCAAGTTTGGCAGCAAGGAAGAATACATGTCCTTCATGAACCAGTTCCTG
GAGCACGAGTGGACCAACATGCAGCGCTTCCTGTTGGAGATCTCCAACCCCGAGACCCTTTCCAACACAGCAGGCTTCGA
GGGCTACATAGACCTGGGCCGGGAGCTCTCTAGCCTGCACTCCCTGCTCTGGGAAGCTGTCAGCCAGCTTGATCAG
Sequence Type mRNA
Unitrap ID UNI2504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35570887..35572792 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es