Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13248H3
Clone ID IST13248H3
Vector VICTR74
Project tigm

Sequence tag IST13248H3HMF1
Sequence
NGGTCAAGGAGCCCGGTTCCCAGGGTCTGAGGGAGGANATCTGTCNAGGTCN
Sequence Type genomic DNA
Unitrap ID UNI31145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52830355..52830396 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030826 (Bcat2) NM_009737 branched chain aminotransferase 2, mitochondrial Gene [Source:MGI (curated);Acc:Bcat2-001]


Sequence tag IST13248H3HMR1
Sequence
NAAGGTCGTGTGTACCCAGTTTACGCGTGGAGAGGAGGCACTGGGGCGGTCTCTGCCAAGGACCCAGTGCCCAAGGCGGG
AGAGGAGGTCCTTGGGGACCCCTTCCCTTCCTAACTTTCTAACTGCTGGGCCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI10502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88725140..88725275 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es